PrimersList
analyzes different features of multiple primers simultaneously, the melting temperature calculation for standard and degenerate oligonucleotides, GC content; primers are analyzed for all primer secondary structures including hairpins, self-dimers and cross-dimers in primer pairs; sequence linguistic complexity, molecular weight, the extiction coefficient, the optical density (OD).
Write or paste your primer sequences to the input field (upper window). The analyzer accepts text and table format (can be copied from an Excel file, for example). Note: This analyzer requires at least 1 primer sequence in the input field.
- A name is (not) required for each primer (eg. Seq1 agtcagtcagtcagtcagtc).
- The name and sequence string can be separated with either space or tab, as long as the style is the same for all the primers.
- Degenerate primer sequences are also accepted, each letter represents a combination of one or several nucleotides: B=(C,G,T), D=(A,G,T), H=(A,C,T), K=(G,T), M=(A,C), N=(A,C,G,T), R=(A,G), S=(G,C), V=(A,C,G), W=(A,T), Y=(C,T). U=Uracil, I=Inosine and LNA: dA=E, dC=F, dG=J, dT=L.
- Linguistic sequence complexity (LC%) is a measure of the 'vocabulary richness' of a genetic text, based on counting the number of possible nucleotide combinations ('entropy' of the set of possibilities) relative to the theoretical maximum. This sequence value is converted into a percentage, with 100% representing the highest possible level.
- Linguistic sequence complexity (YR%) is a measure of genetic text 'harmony' based on counting the number of possible purine-pyrimidine combinations relative to the theoretical maximum. This sequence value is converted into a percentage, with 100% representing the maximum possible level.
The results will appear instantly in the output fields (lower windows), and update automatically if you make changes to the sequences. The results can be copied and pasted to other programs (Word, Excel, etc.). The analyzer will give the following results:
- Tm (°C)
- CG content (%)
- Sequence linguistic complexity (LC%)
- Length of the primers (nt)
- Number of individual bases (A, T, C and G)
- Extinction coefficient (l/(mol·cm))
- Molecular weight (g/mol)
- Amount/OD unit (nmol/OD260)
- Mass (µg/OD260)
- Primer-dimer estimation
| Parameters for calculation of oligonucleotide Tm: | |
| Primer concentration (0.01-5 µM): | µM |
| Total salt (Na+, K+, NH4+, Tris+) concentration (1-1000 mM): | mM |
| Mg2+ concentration (0-10 mM): | mM |
| Value of the sensivity for primer dimer detection (1-10): |