Help

• Multiplex PCR: favors primer sets with reduced cross-dimers; use tighter Tm bounds.
• TaqMan / MGB probe assays: enable one option at a time; probes are designed within the amplicon under assay-specific constraints.
• RPA: shifts to longer primers and short amplicons suitable for ~37–42 °C isothermal workflows.
• Inverse PCR: assume circular template; ensure the marked region is consistent with circular amplification logic.
• C>>T bisulfite conversion: converts non-CpG cytosines for in silico evaluation on bisulfite-treated sequences.
• Overlapping primers: relaxes constraints on overlap where necessary (use cautiously).

• RPA-optimized design: Generates 30–38 nt primers and optional Exo/Nfo probes tuned for 37–42°C, short (100–200 bp) amplicons, and low-copy targets — ideal for point-of-care and field diagnostics.
• Multiplex at scale: Automatically balances primer sets to minimize cross-dimers and ΔG conflicts, enabling fluorescence probe-based multiplex real-time qPCR and parallel RPA panels.
• Genotyping ready: Designs and validates primer/probe sets for SNP and InDel discrimination, including allele-specific and hydrolysis-probe assays.
• Targeted specificity: Built-in off-target screening against reference genomes/pan-genomes and structure-aware filtering for high on-target yield.

Sequences are expected to be represented in the standard IUB/IUPAC nucleic acid codes. Acceptable letters:

The structure of the last nucleotides at the 3′-end of the primer can be specified to control primer specificity:

• N — any pattern (no constraint)
• One, two, three, or more characters using standard or mixed letters
• Multiple patterns of equal length separated by spaces: sws ssw sww wss www

For example, the pattern WSS corresponds to all variants of the 3′-end composition: acc acg agc agg tcc tcg tgc tgg.

The pre-designed primers/probes list is used for multiplexing with prior designed PCR primer/probe sets. This allows you to incorporate existing validated assays into new multiplex panels while ensuring compatibility and avoiding cross-reactivity.

You can specify locations for both Forward and Reverse primer design using [ and ] inside each sequence. Optionally, use two /.../ signs for excluded regions (can be repeated multiple times).

All possible combinations:

1. [SNP/InDel]           — variant targeting
2. [ ]  [ ]                  — separate Forward and Reverse regions  
3. [ [ ] ]                  — nested/overlapping regions

Design of specific PCR primers for in silico bisulfite conversion for both strands. Only cytosines not followed by guanine (non-CpG context) will be replaced by thymines. CpG methylation sites are preserved:

5′ aaCGaagtCCCCa 3′       5′ aaCGaagtTTTTa 3′
   |||||||||||||    →       ||||||:|::::|
3′ ttGCttCagggg t 5′       3′ ttGCttTagggg t 5′

CpG sites (shown in red) remain as C, while non-CpG cytosines (shown in blue) are converted to T.

Oligonucleotide specificity is one of the most critical factors for good PCR. Optimal primers should hybridize only to the target sequence, especially when using complex genomic DNA as a template.

Hydrolysis probes are typically labelled with a fluorophore reporter at the 5′ end and a quencher (such as the Eclipse Dark Quencher, EDQ) at the 3′ end. During amplification, the DNA polymerase exonuclease activity cleaves off the reporter, allowing for signal unquenching and detection.

Minor Groove Binders (MGBs) selectively bind non-covalently to the minor groove (a shallow furrow in the DNA helix). Dual-labelled probes conjugated with MGB groups form extremely stable duplexes with single-stranded DNA targets, enabling shorter probe lengths and superior quenching.

If you need universal tails/adapters, provide sequences in the Forward primer tail and/or Reverse primer tail fields. The tool reports final primers including tails.

For single nucleotide polymorphisms (SNPs), place the variant in square brackets:

>1
gctctctgtgtctgatccaagaggcgaggccagtttcatttgagcattaa[A/G]tgtcaagttctgcacgctatcatcatcaggggccgaggcttctctttgtt

>2
tcatattccagtttgggcgagttttaagataggtccgg[S]acagtctttgcggcgccaacgcgtctttctccagcagacagtccccggactgc

>3
tcatattccagtttgggcgagttttaagataggtccgg[C]acagtctttgcggcgccaacgcgtctttctccagcagacagtccccggactgc

In the second example, [S] represents G/C using the IUPAC ambiguity code.

AS-PCR assays can discriminate insertion/deletion polymorphisms. Only differences between the variants must be shown within the brackets. Leave one side empty for deletions:

>1
tcatattccagtttgggcgagttttaagataggtccgg[AG/]acagtctttgcggcgccaacgcgtctttctccagcagacagtccccggactgc

The program imposes no size limit on length difference for InDels alleles, provided that all alleles can be aligned with sufficient overlapping length to target primers.

Detection of Multi-Nucleotide Variants (MNV) is possible using KASP. Submit sequence information using the [allele1/allele2] format:

>1
tgggcagcattagtagaagaaagtacaagaccgtgtgtagaggatactct[GATATACTTGAG/CAGTCC]agcagatagcgttggataggcgacaggattattggagcgccgtcgagaac

KASP assays can detect haplotypes of any size. The [square brackets] should surround all SNPs that are part of the haplotype. Nearby SNPs not part of the haplotype should be outside brackets and identified using the appropriate IUPAC ambiguity code:

>1
caaacaccaaactggtgagtcgtggtttacaacacgggagttcaaaactg
[TATCCGAATGACGAATGTTCACGTCCTTAAAC
/CATCCGAATCACGAATGTTCAGTTCCTTTAAG]
catcatgaaatgagtttagtttgggtggctcgtaagtagacataaggcac

Use two /.../ signs to mark the start and end of excluded regions. This prevents primer placement in problematic areas (e.g., repeats, secondary structure). Can be used multiple times:

>1
ACGTACGT/REPEATREGION/ACGT[A/G]ACGT/ANOTHERREPEAT/ACGTACGT

The structure of the last nucleotides at the 3′-end of the primer can be specified to control primer specificity:

• N — any pattern (no constraint)
• One, two, three, or more characters using standard or mixed letters
• Multiple patterns of equal length separated by spaces: sws ssw sww wss www

For example, the pattern WSS corresponds to all variants: acc acg agc agg tcc tcg tgc tgg.

Linguistic sequence complexity (LC%) measures the "vocabulary richness" of a genetic text, based on counting the number of possible nucleotide combinations ("entropy" of the set of possibilities) relative to the theoretical maximum. This value is converted into a percentage, with 100% representing the highest possible complexity. Higher LC% helps avoid low-complexity and repetitive regions that can cause non-specific priming.

If supported on the page, you can retrieve flanking sequence around a list of rsIDs by providing:

• Species (e.g., homo_sapiens, arabidopsis_thaliana)
• rsIDs (space/comma separated)
• Flank size (± bases)

ASP primers can be designed following standard KASP guidelines (LGC Biosearch Technologies) carrying the standard FAM and HEX tails. Enter tails in FASTA-like format:

>FAM
GAAGGTGACCAAGTTCATGCT
>HEX
GAAGGTCGGAGTCAACGGATT

The 5′-tails are automatically added to each primer. Custom tails can be used instead of the standard sequences.

Oligonucleotide specificity is one of the most critical factors for good PCR. Optimal primers should hybridize only to the target sequence, especially when using complex genomic DNA as a template.

1. Paste/upload target sequences in FASTA.
2. Provide primer/probe list (if the page includes a dedicated tab for it).
3. Run analysis and review both Results and Log output tabs.
4. If you see no output, confirm that the tool produced hits within the allowed product size range, and verify primer orientation (forward/reverse).

Optimal LAMP primer sets require specific spacing between primer regions:

LAMP primers have different melting temperature requirements depending on their role:

Primers should be designed to avoid secondary structures that impair amplification:

• Avoid primers that form hairpins or self-dimers
• The 3′-end sequence should not be AT-rich
• The 3′-end should not be complementary to other primers in the set (to avoid primer-dimers)

Linguistic sequence complexity (LC%) measures the "vocabulary richness" of a genetic text, based on counting the number of possible nucleotide combinations ("entropy" of the set of possibilities) relative to the theoretical maximum. This value is converted into a percentage, with 100% representing the highest possible complexity. Higher LC% helps avoid low-complexity and repetitive regions that can cause non-specific priming or poor amplification efficiency.

Sequences are expected to be represented in the standard IUB/IUPAC nucleic acid codes. Acceptable letters:

The structure of the last nucleotides at the 3′-end of the primer can be specified to control primer specificity:

• N — any pattern (no constraint)
• One, two, three, or more characters using standard or mixed letters
• Multiple patterns of equal length separated by spaces: sws ssw sww wss www

For example, the pattern WSS corresponds to all variants of the 3′-end composition: acc acg agc agg tcc tcg tgc tgg.

• Use [ ... ] to constrain primer design to a specific region.
• Use / ... / to exclude regions (e.g., repeats) from primer placement; can be repeated multiple times.

• Target sequence(s) in FASTA. For best performance, keep each target < ~1 Mb.
• Amplicon size range: choose by platform (e.g., shorter for Illumina; longer for ONT).
• Gap between amplicons: set to 0 for full coverage; increase if you want fewer primers.
• Optional pre-designed primers/probes: provide a list if you want compatibility with existing assays.

If the page interface suddenly stops working after you updated files on the server (for example, buttons do nothing, tabs do not switch, or results are not displayed), the most common reason is that the browser is still using an old cached JavaScript file.

• Confirm the ID is correct (e.g., NCBI nucleotide accession like A02710; rsIDs like rs4988235).
• Network policies (institutional firewall) may block external API calls; use manual FASTA upload in such environments.
• Try again later if the upstream service is rate-limiting or temporarily unavailable.

• Enable Non-specific priming control and increase minimal complexity.
• Avoid designing across low-complexity segments; consider marking exclusion regions with /.../ if the tool supports it.
• For multiplex panels: tighten primer Tm window and reduce allowed cross-dimers (if available).