Calculation of optimal annealing temperature
The optimal annealing temperature (
Ta) is the range of temperatures where efficiency of PCR amplification is maximal. The most important values for estimating the
Ta is the primer quality, the
Tm of the primers and the length of PCR fragment. Primers with high
Tm ´s (>60°C) can be used in PCRs with a wide
Ta range compared to primers with low Tm´s (<50°C). The optimal annealing temperature for PCR is calculated directly as the value for the primer with the lowest
Tm (T
mmin).
However, PCR can work in temperatures up to 10 degrees higher than the
Tm of the primer to favour primer target duplex formation, our empirical formula:

where
L is length of PCR fragment.
In our experience, almost all high-quality primers designed by FastPCR in the default or «best» mode provide amplification at annealing temperatures from 68 to 72°C without loss of PCR efficiency, and show good amplification in varying PCR annealing temperatures and when using different DNA polymerases and buffers.
Example
Prediction the
Ta of PCR and PCR fragment(s) length for one or more existing primers (using
-npd command) for current sequences:
{ -PR[gcgaaaaccaagtgcttacctcg/atactccctccgtccctaaa] -npd }

The result is:

Another option is determining the value of the
Ta is to use
in silico PCR: