PCR set-up examples

Example: PCR primer design to Simple Sequence Repeat (SSR) loci (200 bp around SSR):

> -ssr/200

Example: prediction Ta (temperature of annealing) of PCR and PCR fragment(s) length for one or more existing primers (with -npd command) for current sequence:

> -fpr[ggagagtagcttacctcgct cggtaaggttcttcatgc] -npd

LATE-PCR example: necessary to select forward and reverse primers with a difference in Tm of about 10 degrees:

> -Ftm50-55 -Rtm64-68 -pTMs10

How to make primer with adapter sequence (user defined) in either 5' or 3' or both end of the primer:

1) Select the adapter sequence you want to use
This can be A) at the 5' end of the final primer, such as sequence containing a restriction sequence for downstream handling of the PCR products or
B) at the 3' end of the final primer such as adapter for precise PCR amplification of a known sequence. You can make the 5' end of this primer also fixed such as restriction site or specific for annealing site for additional PCR primer.
C) The adapter sequence can also be designed at both 5' and 3' ends.
In all cases (A, B and C) the primers will be tested by the program against the whole template sequence provided by the user.

2A) The adapter at 5' end:
Type the command -5e, or -F5e (Forward) or -R5e (Reverse) after the name of the sequence and type the sequence of the adapter immediately after the command.
Example:
> -F5eCGACG or -R5eTTTTTT
If you want complementary sequence then add letter "c":
Example:
> -Fc5eCGACG - program convert to complement 5'-CGTCG (equal to -F5eCGTCG)

2B) The adapter at 3' end:
Type the command -3e, or -F3e (forward) or -R3e (reverse) after the name of the sequence and type the sequence of the adapter immediately after the command.
Example:
> -F3eGGTTC or -R3eCCTT
If you want complementary sequence then add letter "c":
Example:
> -Fc3eGGA
- program convert to complement 5'-TCC (equal to -F3eTCC)

2C) The adapter at both 5' and 3' ends at the same time:
Type both commands -3e and -5e after the name of the sequence and type the sequence of the adapter immediately after the commands.
Example for Forward primers:
> -F3eGG -F5eGG

Hint: you can also design the 5' or 3' end of the primer to behave as a specific template for secondary PCR amplification by using the random DNA generated by the program as a template sequence (see the "Tools" => "Generate Random DNA").
The primers created against the random DNA are unique and usually do not match to any sequence found in databases. This is why they are suitable to use in secondary PCR amplification reactions where false annealing sites are not desired. However, you may need to ensure this by blasting this random part of the adapter against relevant databases and/or in case of longer primer-adapter molecules fold them (by using mFOLD etc.) to screen out any primers showing any unwanted secondary structures.