jPCR
java application is based on FastPCR software and provides comprehensive facilities for designing primers for most PCR applications and their combinations including:
standard, long distance, inverse, real-time, unique, group-specific, bisulphite modification assays, multiplex,
polymerase extension PCR multi-fragments assembly cloning or ligation-independent cloning of PCR products (LIC-PCR);
tool for identifying simple sequence repeat (SSR) loci by analysing the low complexity regions of input sequences;
in silico (virtual) PCR primers and probes search, prediction of probable PCR products and search of potential mismatching location of the specified primers or probes;
comprehensive primer test, the melting temperature calculation for standard and degenerate oligonucleotides including LNA and other modifications, PCR efficiency, dimers detection and dilution and resuspension calculator; analyzes different features of multiple primers simultaneously;
Oligonucleotides design for assembly long sequence or polymerase chain assembly (PCA) - created to automate the design of oligodeoxynucleotides for the PCR-based construction of long DNA molecules (the desired gene sequence is segmented into short oligo sequences.
The program includes various bioinformatics tools for patterns analysis of sequences with GC:(G-C)/(G+C), AT:(A-T)/(A+T), CG-AT:(S-W)/(S+W), purine-pyrimidine (R-Y)/(R+Y) skews, CG% content and the melting temperature and considers linguistic sequence complexity profiles.
Java application needs a Java Virtual Machines (Sun) (the Java Runtime Environment (JRE) or complete Java Development Kit (JDK), for programmers only, can be downloaded from java.com).
Import sequence(s), about Sequence Formats
Open … (Ctrl-O) - open any text and .RTF file with DNA sequence(s), or .XLS TAB-column formatted text files, maximum DNA length is 100Mb, for 64-bit Java)
Prepare your sequence data file using a text editor (Notepad, WordPad, Word), and save in ASCII text format (plain text) or Rich Text Format (.RTF).
You can type in "Sequence editors" or import nucleotide sequence(s) from file or from the clipboard (Shift-Insert, Ctrl-V) as simple text or Excel sheet or Word table (two columns), the table with TAB or whitespace separators.
Importing sequences must be at the same format.
For individual, selective options and task, sequences need convert to FASTA format with “>”, these options have a highest priority. Any of these following commands must be written AFTER the sequence name or “> ” (these commands are not case sensitive) and press Enter and the end of line. The commands can occupy any place in the command line.
When sequences are imported you may edit the sequences in general or additional editors and immediately visualize the result of editing. Press "Ctrl-R" switch on-typing sequence interpretation to on or off. You can modify a nucleotide sequences by inserting, deleting and replacing sequence fragments.
Degenerate primer sequences are also accepted:
IUPAC code is an extended vocabulary of 15 letters which allows the description of ambiguous DNA code. Each letter represents a combination of one or several nucleotides:
B=(C,G,T), D=(A,G,T), H=(A,C,T), K=(G,T), M=(A,C), N=(A,C,G,T), R=(A,G), S=(G,C), V=(A,C,G), W=(A,T), Y=(C,T).
Raw format (ASCII)
Like a text/plain format without white space and TABs. It read only standard IUB/IUPAC amino acid or nucleic acid codes characters and rejects anything else, low- and upper-case insensitive. Digits or else are removed and ignored (but Tab and space characters with combination end line character (Enter press) can be interpreted as column format). Here are some examples of raw formatted sequence: ataaattcttattttgacactcaccaaaatagtcacctggaaaacccgctttttgtgaca
FASTA format description
FASTA format have a highest priority and is simple as the raw sequence proceeded by definition line. The definition line begins with a “>” sign and optionally followed immediately by a name for the sequence with using any length and amount of words. Many sequences can be listed in the file, the format indicating a new sequence at each new “>” symbol found. It is important to press Enter at the end of each line after “>” to help FastPCR recognize the end and beginning of sequence and sequence’s name. Make sure the first line starts with a “>” and has (has not) a header description.
The description must be contained within one line and not run into 2 or more lines. The sequence starts directly on next line. As for the previous raw data format, sequences must be in the standard IUB/IUPAC amino acid or nucleic acid codes, any other characters - digits, spaces, TAB characters or else are ignored, low- and upper-case insensitive:
>
cggccgagatcaggcgatgcatg
>
acgacgacgcagctatattacag
Tables format description
You can directly import the table from text file or from the clipborad via copy and paste operations from Microsoft Word or Excel sheet (or OpenOffice), or primer’s list from FastPCR's or jPCR "PCR design result", or the table with TAB or whitespace separators. Software reads only first two columns with names and sequences:
| 1F1_234-253 | agggagtagcttacctcgct |
| 2F1_263-283 | gcgaaaaccaagtgcttacct |
| 3F1_290-313 | tcctcaagcgaaaaccaatccaca |
| 4F1_318-338 | tgttcacatgtttggggacga |
| 5F1_545-564 | gcttgtaaggcaaacccaca |
| 6F1_606-625 | acgtggtactcatggtgtca |
| 7F1_668-689 | cccaacggtttacctcaagggt |
| 8F1_1071-1093 | tcgcgaccttatgagaacgctgc |
| 9F1_1112-1131 | aagcagcgaccgacgaaacc |
To check the correct format was read, look at the information in Sequence TAB and under text editor in the status bar:
As for the previous raw data format, sequences must be in the standard IUB/IUPAC amino acid or nucleic acid codes, any other characters - digits, spaces or else are ignored, low- and upper-case insensitive. Tab character or spaces are used for recognition columns. Other simple table format is with or without name for primers (probes or else); name is replaced by single space (space inside sequence not allowed) and the end of each sequence, press Enter is necessary:
- acgaatcgtattcaagcctgc
- gcgtcatctggctgctacctcga
- cgagcttagtcttcaacgccaa
- agaggacgctcgtgtctttcggac
- gctcacgtcaaagtcttgtccgag
In case using sequence’s name, no space inside names and sequences are allowed.
Software always indexing each sequence from 1 to N, therefore doesn’t matter if some sequence’s name are the same or absent:
1 acg aat cgt att caa gcc tgcccg tca tct ggc tgc tac ctc ga
cga gct agt ctt caa cgc caa
1 aga gga cgc tcg tgt ctt tcg gac
General PCR primer options
For PCR primers are usually 18-35 bases in length and should be designed such that they have complete sequence identity to the desired target fragment to be amplified. Parameters controllable by the user are primer length (12-500nt), melting temperature calculated by nearest neighbour thermodynamic parameters, theoretical primer PCR efficiency (quality at %) value, primer CG content, 3’end terminal enforcement, preferable 3’termini nucleotide sequence composition in degenerated formula and additional sequence at 5’ termini.
The other main parameters used for primer selection are: the general nucleotide structure of the primer such as linguistic complexity (nucleotide arrangement and composition); specificity; the melting temperature of the whole primer and the melting temperature at the 3’ and 5’ termini; a self-complementarity test; secondary (non-specific) binding search:
- Quality Limit (PCR primer amplification efficiency), this abstract value of the ‘primer quality’ describes thus the level of primer/PCR successfulness; this value varies from 100% for the “perfect or ideal” to 0% for the "worst" primer. A “perfect” primer has a wider range of executable temperatures. A program is select the best primer with optimal range of executable temperature, which allowed to design qualified primers (probe) for any target sequences with any CG and repeat contents.
- Linguistic Complexity Control: the complexity values were converted to a percentage value, in which 100% means maximal ‘vocabulary richness’ of a sequence.
- 3'-End Composition (5'-3'): you can choose with 5’ or 3’ ends is most preferable for all primers or probe. Minimal size is 2 letter (maximum – primer length), “5’-nn-3’” is any, “5’-sww-3’” – all variants for 5’-(C/G)(A/T)(A/T)-3’”. You can type one or more variants with space between them and with the same length.
- С >> T bisulphite conversion: bisulphite modified genome sequence, design of specific PCR primers for in silico bisulphite conversion for both strands - only cytosines not followed by guanidine (CpG methylation) will be replaced by thymines: 5’aaCGaagtCC-3' 5’aaCGaagtTT-3'
- Alternative Amplification (Non-Specific Binding ) Control: the program will analyse primers at current sequence and at "Reference dataset (non-specific primer binding test)" (using quick hash-table alignment) and look for the presence of possible additional complement sites for each primer (probe), which would result in non-specific PCR product. Usually, the site-specificity of the primer can be checked by performing a sequence homology search (e.g. blastn) through all known template sequences in the public genome database such as National Center for Biotechnology Information (NCBI), but it is no necessity, our experience, the almost all problems can be simply solving using any the BAC sequence(s) (about 100,000 or more bases) from analysing genome, because only high copy number repeats will compromise the performance of unique PCRs so, unless the experiments are planned specifically to exploit them, they are best avoided.
|||||||||| -> |||||| |
3’ttGCttCagg-5' 3’ttGCttTagg-5'
PCR primers and probes design command lines
Any of these following commands must be written AFTER the sequence name or “>” (these commands are not case sensitive) and press Enter and the end of line. The commands can occupy any place in the command line.
| -pdN1-N2 -FpdN1-N2 -RpdN1-N2 -pdN1-N2/N3 | (Primer Design) to define position of the target DNA on initial N1 and final N2 position (N2>N1) in DNA sequence: > -pd350-700 design PCR primers between coordinate N1 and N2 (N2>N1) for Forward or Reverse: > -Fpd100-500 -Rpd1000-1200 You can specify the area in which to search for primers around the area (-pdN1-N2/N3), for example, interested area 400-500, and we want to pick up primers surrounding the site within 100 bases, whereas the primers for Forward will be between 300-400, and 500-600 for Reverse: > -pd400-500/100 this command is equal to -Fpd300-400 -Rpd500-600 generally: -pdN1-N2/N3 is equal to -Fpd(N1-N3)-N2 -RpdN2-(N2+N3) |
| -pdN-e -FpdN-e -RpdN-e | Design PCR primers in area: from the end of sequence minus N bases design left or right PCR primers from the end of sequence minus N bases: > -Fpd200-e > -Rpd200-e |
| (N1-N2) | specify the minimal and maximal size requested for the PCR product, N1 for shortest, N2 for the longest PCR product (N1=N2 is allowed): > (400-500) |
| -npd -Fnpd -Rnpd | No Primer(s) Design, restriction for design primers only for forward or reverse or for both primers; but be shown the primers which added with command -fp= : > -npd |
| -pcrNo | No PCR primer combinations reporting, but showing all primers: > -pcrNO |
| -npcN1 | Determine the maximum Number of Primers Combinations, for example 10 (0 is allowed): > -npc10 |
| -oYes|No -FoYes|No -RoYes|No | Primers pverlapping control: if type -FoNo, all forward primers will not overlap; -RoYes all reverse primers will overlap: > -oyes |
| -lnN1-N2 -FlnN1-N2 -RlnN1-N2 | Minimal-Maximal length for Forward or (and) Reverse primers design: > -Fln18-22 -Rln22-22 |
| -tmN1-N2 -FtmN1-N2 -RtmN1-N2 | Minimal-Maximal Tm for Forward or (and) Reverse primers design: > -Ftm40-50 -Rtm50-60 |
| -cgN1-N2 -FcgN1-N2 -RcgN1-N2 | Minimal-Maximal CG% for Forward or (and) Reverse primers design: > -Fcg45-55 -Rcg50-60 |
| -5e -F5e -R5e | Primer 5'-End Tail: additional and an artificial DNA sequence. which will be added to 5' of primers (probes) (any length): > -F5eCGACG -R5eTTTTTT |
| -c5e -Fc5e -Rc5e | Primer 5'-End Tail, additional, artificial complement DNA sequence to 5' of primers (probes) (any length): > -Fc5eCGACG - program convert to complement 5'-CGTCG (equal to -F5eCGTCG) |
| -3e -F3e -R3e | Primer 3'-End Tail: additional and an artificial DNA sequence. which will be added to 3' of primers (probes) (any length): > -F3eGG -R3eСС |
| -c3e -Fc3e -Rc3e | Primer 3'-End Tail, additional, artificial DNA sequence to 3' of primers (probes) (any length): > -Fc3eGG - program convert to complement 5'-CC (equal to -F3eCC) |
| -ptmsN1 | Synchronizing Tm for Primer Pair (±°C): > -ptms10 |
| -ssr/N or -ssr | Design PCR primers to SSR loci software automatically finds Simple Repeats target Sequence and will design primers: N is optional value for distance before (Forward primers) and after (Reverse primers) SSR loci: > -ssr/200 |
| -fp= -Ffp= -Rfp= | Pre-designed (Fixed) Forward or Reverse one or more primers, always use the actual primer sequence (5'->3') without space with automatically detection the primer's location with mismatches; analyzes more than one primer for both DNA chains: > -fp=attccattccgcgttcga -fp=atcctacgttccgttacc pre-designed Forward and Reverse PCR primer: > -Ffp=attccattccgcgttcga -Rfp=acgttacggtatttcttgc |
| -fx3e -Ffx3e -Rfx3e -fx5e -Ffx5e -Rfx5e | Design PCR primer for a specific sequence on the fixed 5' or 3' ends to selected sequence, for example, if you need to link all primers to 5'end of sequence, use -fx5e, program will show all primers with the same location but different length. The same situation is for a linkage the 5'end of primers to a certain location: > -fx5e |
Use of these brackets differs from software Primer3, for example:
1. The same location for both Forward and Reverse primers will be designed in the central [nnnnnnnnnn] part (only once '[ ]' is used):
...AAAAAAAAAA[nnnnnnnnnn]CCCCCCCC...
2. Different locations for Forward and Reverse primers; Forward (red) primers will be chosen inside [1nnnnnn] location and Reverse (blue) primers inside [2nnnnnn] location, (twice '[ ]'):
...AAAAAAAAAA[1nnnnnn]AAAAAAAA[2nnnnnn]AAAAA...
3. Design primers must flank the central ]nnnnnn[ ; Forward primers will be chosen from 1 to A] bases and Reverse primers will be chosen from [C base to the end of sequence:
...AAAAAAAAAA]nnnnnn[CCCCCCC...
4. Design primers with overlapping part [nnnnnn] for Forward and Reverse primers;
Forward primers will be chosen from [A to n] bases and Reverse primers will be chosen from [n base to C]:
Forward--------------¬
| |
...[AAAAAAAAAA[nnnnnn]CCCCCCC]...
| |
---------Reverse
Program allow to select up to 1000 independent PCR primers (probe) designing tasks for each sequences using multiple combinations of '[..]' and -FpdN1-N2, -RpdN1-N2 or -pdN1-N2 commands.
Multiplex PCR can be carried out simultaneously within a single sequence with multiple tasks as well as for different sequences or multiple tasks or both cases together.
All possible combinations of '[ ]' (Forward) with '[ ]' (Reverse) within the sequence(s):
1. [ ]
2. ] [
3. [ ] [ ]
4. [ [ ] ]
5. ([ ] [ ] )n or(and) ([ [ ] ])n
PCR set-up examples
- Example for PCR primer design to Simple Sequence Repeat (SSR) loci (200 bp around SSR):
> -ssr/200 - Example prediction Ta (temperature of annealing) of PCR with one or more existing primers (with -npd command) for current sequence:
> -fp=gagagtagcttacctcgct -fp=cggtaaggttcttcatgc -npd - LATE-PCR example, necessary to select forward and reverse primers with a difference in Tm of about 10 degrees:
> -Ftm50-55 -Rtm60-65 -pTMs10
PCR Output Result
Application automatically generate results in "Results Tab" at tabulated format (ready for transferring to Excel sheet via copy and paste operations); the output results is easy to save as .XLS Text file, compatible for Excel or Open Office:| PrimerID | Sequence(5'-3') | Length (bp) |
Tm (°C) |
Tm 3'end(°C) |
CG(%) | Linguistic complexity (%) |
Quality (%) |
| >1 | |||||||
| 1F1_1_13-34 | aattgccccgcccaacacgggt | 22 | 66,2 | 35,6 | 63,6 | 92 | 93 |
| 1F2_1_39-59 | aggtgtgtgagcctcgactgt | 21 | 59,7 | 33,3 | 57,1 | 89 | 97 |
| 1F3_1_52-72 | tcgactgttcctcgccataag | 21 | 56,3 | 29,9 | 52,4 | 98 | 91 |
| 1F4_1_64-86 | cgccataagaaccctagtgcgga | 23 | 60,6 | 33,5 | 56,5 | 98 | 97 |
Primers ID (Identifiers) designed format:
PCR product output, each line contains compatible primer pair (Forward and Reverse primers):
| Forward PrimerID |
Sequence(5'-3') | Tm(°C) | Primer Quality (%) |
Reverse PrimerID |
Sequence(5'-3') | Tm(°C) | Primer Quality (%) |
PCR Fragment Size(bp) |
Topt (°C) |
| 1F1_1_13-34 | aattgccccgcccaacacgggt | 66,2 | 93 | 1R3_1_529-552 | gcatccggtttacaaggccgttg | 61,1 | 97 | 540 | 60,2 |
| 1F1_1_13-34 | aattgccccgcccaacacgggt | 66,2 | 93 | 1R4_1_506-529 | gttgaactgccgcgccgtcttac | 62,8 | 95 | 517 | 60,7 |
| 1F1_1_13-34 | aattgccccgcccaacacgggt | 66,2 | 93 | 1R8_1_401-424 | ggtcaggtgaagtggcatcctgc | 62,3 | 97 | 412 | 60,3 |
| 1F2_1_39-59 | aggtgtgtgagcctcgactgt | 59,7 | 97 | 1R1_1_571-591 | tatccgcagctcgttgcttc | 57,3 | 92 | 553 | 59,1 |
Multiplex primer design
The user can also input options for the PCR product involving the minimum product size differences among the set of designed primer pairs. It also allows to set primer design conditions individually for each given sequences or using common options. The individual setting have highest priority to PCR primer or probe design than general settings. The result includes primer sequences for individual sequences, their compatible primer pairs with product size and annealing temperature and final result for compatible primer pairs for each sequence with all information includes primer pair sequences, product size and annealing temperature. It is ideally to design all primer pairs with near equal annealing temperature in single reaction. For most cases the multiplex PCR conditions are resisting to a small variation (up 7°C) of Ta between all primer pairs and PCR products. Synchronizing Tm for primer pair user can control from “Primer Design Options” or with command: -ptms5.
The annealing temperature must be optimal in order to guarantee effective amplification of the targets genomic sequence while minimizing the risk of unspecific amplification. To amplify the target genomic sequence effectively, the primers “quality” and properties should be highest. PCR primer design for multiplex PCR can be performed for standard or inverted PCR pairs or both of them. A minimum of two sequences must be implemented for this analysis. The program will find the compatible primer pairs for each sequence and will make a continuous numbering of pairs for all investigated sequences.
Another feature of the program, user can select not only compatible pairs of primers, as well as compatible single primers for different targets or sequences. That is, program can design both pairs of primers and single primers or only single primers for different targets:
Group-specific (family-specific primer set) and Unique PCR primers design
The group-specific amplification also call as family specific or universal amplification is most important tool for comparative studies of genes and genomes, including studies of evolution and cloning new sequences. The specific sequences that link to concrete organism can be discovered by DNA polymorphism in these conservative genome regions (genes, transposable or repeat elements). For detection DNA polymorphism in relative sequences will help with design PCR primers around this polymorphic region.
The overall strategy of designing group-specific PCR primers is standard PCR design of only to regions of sequence common to all sequences (hash-table base alignment).
The test primer complementarity performed with fast no gap local hash-table alignment includes parameters for amount of mismatches at the 3’-end of primers and primers similarity to target sequence.
Program automatically specify the alignment parameters (the same as for in silico PCR) for primers searching – “initial searching word size, >3 (default = 7), nt”, important length of 3'-end, 5...20, nt for testing mismatches, minimal complement primer length (>12, nt) and the local similarity (default = 80%)”.
An output PCR result contains the group-specific PCR primers from each sequence and compatible primers combination with product size and temperature annealing.
jPCR automatically designs larger sets of universal primer pairs for all given related sequences, identifies conservative regions without sequence alignment and generates suitable primers for all given sequences. All steps of algorithm are automatic and you can influence to the general options for primer design and alignment options. jPCR will work only with any source of related sequences as long as it is possible to found short consensus sequences. The quality of primer design is dependent on both on sequence relationship, phylogenetic similarity and suitability of the consensus sequence to the design of any good primers. Software is able to generate group-specific primers for each sequence independently, that suit for all sequences.
Unique PCR
The strategy for a unique PCR primer design is opposite to the group-specific PCR primers (probes) design. This case program search unique regions within a DNA sequence and automatically designing primers with minimal user intervention and maximum flexibility.
In silico (virtual) PCR or primers (probes) searching
This in silico tool is very attractive for quick analysing primer or probe through target sequences, for determination primer (probe) location, orientation, efficiency of binding, complementarity and Tm calculation.
The prediction appropriated short or long primer (probe) annealing site is only one way for PCR product prediction. Primer can bind many predicted sequences in template(s), but only sequences with few mismatches (1 or 2 depends from place and nucleotide) at 3’end of primer can be used for polymerase extension. The last 10-12 bases at 3’end of primer are sensitive to initiation of polymerase extension and general primer stability on binding template site. Single mismatch at these last 10 bases at 3’end of primer depends from the position and the structure can slightly reduced the primer binding and PCR efficiency. This software allows simultaneously testing single primer or list of the individual primer or probe with any length thorough multiplex target sequences. This test control by primer complementarity to target sequence performed with fast no gap alignment.
Oligonucleotides with degenerated sequence are fine for performing this test.
The probable PCR product can found for linear and cycle molecular, for standard, inverted PCR and for multiplex PCR.
- Enter primer sequences: Paste the primer sequence(s) in the additional editor in any format acceptable for FastPCR.
- C >> T bisulphite conversion: bisulphite modified genome sequence, design of specific PCR primers for in silico bisulphite conversion for both strands - only cytosines not followed by guanidine (CpG methylation) will be replaced by thymines.
- Probe Search: with not complemental tail on 5’end and on 3’end to target is not problem for performing this test.
Oligo Test
Individual oligo are evaluated, it calculate primer Tm’s using default or other formulae for normal and degenerate nucleotide combinations, CG content, extinction coefficient, unit conversion (nmol per OD), mass (µg per OD), molecular weight, linguistic complexity, and primer PCR efficiency. Oligo is analysed for intra- and inter-molecular interactions to form dimers.
Users can select either DNA or RNA primers with normal or degenerate oligonucleotides or which can be modified with different labels (for example inosine, uridine or fluorescent dyes). Tools allow the choice of other nearest neighbour thermodynamic parameters or simple non thermodynamic Tm calculation formulae. For example, for non-thermodynamic Tm calculation of oligonucleotides, we suggest using the simple formulae:
Tm = 2(A + T + U) + 4(G + C) (for short < 7 bases)or
Tm = 77.1 + 11.7log [K+] + 0.41(GC %) - 528/L
DNA degenerate code is an extended vocabulary of 15 letters which allows the description of ambiguous DNA code. Each letter represents a combination of one or several nucleotides:
B=(C,G,T), D=(A,G,T), H=(A,C,T), K=(G,T), M=(A,C), N=(A,C,G,T), R=(A,G), S=(G,C), V=(A,C,G), W=(A,T), Y=(C,T).
U=Uracil; I=Inosine. For LNA modifications the four symbols: dA=E, dC=F, dG=J, dT=L are used.
Program perform analyses on-type, which allow users to see the results immediately on screen. They can also calculate the volume of solvent require to attain a specific concentration from the known mass (mg), OD or moles of dry oligonucleotide.
Random DNA Generation
Using TAB editor, you can select the length for generation random DNA sequence with “Generate Random DNA”.
Contact
Dr. Ruslan Kalendar
Reference apply to all Web Tools update, if you use it in your work please cite:
Kalendar R. 2010 Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analyses.[http://primerdigital.com/tools/]
Copyright
The copyrights and other rights to the materials on the PrimerDigital website are owned by PrimerDigital.You are authorized to view the materials at this website only for your internal information purposes provided that you: (i) retain all notices contained in the original materials;
(ii) only use images with surrounding text relating to the images;
and (iii) include the following copyright notice.
These computer programs are protected by copyright law and international treaties. Unauthorized reproduction or distribution of this program, or any portion of it, may be result in severe civil and criminal penalties, and will be prosecuted to the maximum extent possible under law.
No transcoding: you are prohibited from using these softwares with a commercial software or hardware product ("commercial product") whose purpose is to "transcode" or convert application content into an alternate programs. A commercial product is one that directly or indirectly generates revenue for its author and/or publisher.
Copyright © 2010 PrimerDigital. All rights reserved.