Back to PCR and Primers Tools

jPCR

java application is based on FastPCR software and provides comprehensive and professional facilities for designing primers for most PCR applications and their combinations: standard, multiplex, long distance, inverse, real-time, unique, group-specific, bisulphite modification assays, polymerase extension PCR multi-fragments assembly cloning (OE-PCR); and microarray design;
in silico (virtual) PCR or primers and probes search or in silico PCR against whole genome(s) or a list of chromosome - prediction of probable PCR products and search of potential mismatching location of the specified primers or probes;
comprehensive primer test, the melting temperature calculation for standard and degenerate oligonucleotides including LNA and other modifications, primer PCR efficiency, primer's linguistic complexity, and dilution and resuspension calculator; analyzes different features of multiple primers simultaneously, the melting temperature, GC content, sequence linguistic complexity, primer PCR efficiency and molecular weight, the extiction coefficient, the optical density (OD);
primers (probes) are analyzed for all primer secondary structures including G-quadruplexes detection, hairpins, self-dimers and cross-dimers in primer pairs;
tool calculate Tm for primer dimers with mismatches for pure and mixed bases using averaged nearest neighbour thermodynamic parameters and for modifications (inosine, uridine, or LNA);
tool for identifying simple sequence repeat (SSR) loci by analysing the low complexity regions of input sequences;
tool for identifying simple sequence repeat (SSR) loci by analysing the low complexity regions of input sequences;
tool for searching for similar sequences (or primers);
translates nucleotide (DNA/RNA) sequences to the corresponding peptide sequence in all six frames for standard and degenerate DNA and modifications (inosine, uridine);
polymerase chain assembly (PCA) or oligos assembly - created to automate the design oligonucleotide sets for long sequence assembly by ligase chain reaction (LCR) and PCR;
the program includes various bioinformatics tools for patterns analysis of sequences with GC:(G-C)/(G+C), AT:(A-T)/(A+T), CG-AT:(S-W)/(S+W), purine-pyrimidine (R-Y)/(R+Y) skews, CG% content and the melting temperature and considers linguistic sequence complexity profiles.

Please select the amount of your free system memory (RAM) to improve the performace of jPCR

512Mb 1024Mb 2048Mb (64-bit Java and Web browsers) 4096Mb (64-bit Java and Web browsers)





Comparison of primer design and oligonucleotide analysing tools versus other most popular on-line primer design and analysing packages.




The program Structure

Two independent text editors at different TAB: Sequences, Pre-designed primers (probes) list.

TAB: Sequences - for all sequences that will be analyzed, it can be a list of primers or sequences of chromosomes.

TAB: Pre-designed primers (probes) list - only for a list of primers, which will be analyzed in silico PCR, and for PCR to check the compatibility of these primers with primers that will be designed.

Import sequences from a clipboard or right-click mouse displays a contextual menu or from file.


Import sequence(s), about Sequence Formats

The popup menu:

Open content menu

Importing sequences must be at the same format.

Prepare your sequence data file using a text editor (Notepad, WordPad, Word), and save in ASCII text format (plain text) or Rich Text Format (.RTF).
You can type in "Sequence editors" or import nucleotide sequence(s) from file or from the clipboard (Shift-Insert, Ctrl-V) as simple text or Excel sheet or Word table (two columns), the table with TAB or whitespace separators.

For individual, selective options and task, sequences need convert to FASTA format with “>”, these options have a highest priority. Any of these following commands must be written AFTER the sequence name or “> ” (these commands are not case sensitive) and press Enter and the end of line. The commands can occupy any place in the command line.

When sequences are imported you may edit the sequences in general or additional editors and immediately visualize the result of editing. Press Ctrl-R switch on-typing sequence interpretation to on or off. You can modify a nucleotide sequences by inserting, deleting and replacing sequence fragments.



Degenerate primer sequences are also accepted:

IUPAC DNA degenerate code is an extended vocabulary of 15 letters which allows the description of ambiguous DNA code. Each letter represents a combination of one or several nucleotides:
B=(C,G,T), D=(A,G,T), H=(A,C,T), K=(G,T), M=(A,C), N=(A,C,G,T), R=(A,G), S=(G,C), V=(A,C,G), W=(A,T), Y=(C,T). U=Uracil; I=Inosine; and LNA: E=dA, F=dC, J=dG, L=dT.



Raw format (ASCII)

Like a text/plain format without white space and TABs. It read only standard IUB/IUPAC amino acid or nucleic acid codes characters and rejects anything else, low- and upper-case insensitive. Digits or else are removed and ignored (but Tab and space characters with combination end line character (Enter press) can be interpreted as column format). Here are some examples of raw formatted sequence:ataaattcttattttgacactcaccaaaatagtcacctggaaaacccgctttttgtgaca


In case the @ character at the beginning of the sequence name's, the result - the sequence will be translated into complementary (for Alt-1), or remains the original seqience (for other cases).


FASTA format description

FASTA format have a highest priority and is simple as the raw sequence proceeded by definition line. The definition line begins with a “>” sign and optionally followed immediately by a name for the sequence with using any length and amount of words. Many sequences can be listed in the file, the format indicating a new sequence at each new “>” symbol found. It is important to press Enter at the end of each line after “>” to help FastPCR recognize the end and beginning of sequence and sequence’s name. Make sure the first line starts with a “>” and has (has not) a header description.
The description must be contained within one line and not run into 2 or more lines. The sequence starts directly on next line. As for the previous raw data format, sequences must be in the standard IUB/IUPAC amino acid or nucleic acid codes, any other characters - digits, spaces, TAB characters or else are ignored, low- and upper-case insensitive:
>
cggccgagatcaggcgatgcatg

>
acgacgacgcagctatattacag


Tables format description

You can directly import the table from text file or from the clipborad via copy and paste operations from Microsoft Word or Excel sheet (or OpenOffice), or primer’s list from FastPCR's or jPCR "PCR design result", or the table with TAB or whitespace separators. Software reads only first two columns with names and sequences:

1F1_234-253 agggagtagcttacctcgct
2F1_263-283 gcgaaaaccaagtgcttacct
3F1_290-313 tcctcaagcgaaaaccaatccaca
4F1_318-338 tgttcacatgtttggggacga
5F1_545-564 gcttgtaaggcaaacccaca
6F1_606-625 acgtggtactcatggtgtca
7F1_668-689 cccaacggtttacctcaagggt
8F1_1071-1093 tcgcgaccttatgagaacgctgc
9F1_1112-1131 aagcagcgaccgacgaaacc

To check the correct format was read, look at the information in Sequence TAB and under text editor in the status bar:


As for the previous raw data format, sequences must be in the standard IUB/IUPAC amino acid or nucleic acid codes, any other characters - digits, spaces or else are ignored, low- and upper-case insensitive. Tab character or spaces are used for recognition columns. Other simple table format is with or without name for primers (probes or else); name is replaced by single space (space inside sequence not allowed) and the end of each sequence, press Enter is necessary:

  •   acgaatcgtattcaagcctgc
  •   gcgtcatctggctgctacctcga
  •   cgagcttagtcttcaacgccaa
  •   agaggacgctcgtgtctttcggac
  •   gctcacgtcaaagtcttgtccgag

In case using sequence’s name, no space inside names and sequences are allowed.


Software always indexing each sequence from 1 to N, therefore doesn’t matter if some sequence’s name are the same or absent:

1 acg aat cgt att caa gcc tgc
  ccg tca tct ggc tgc tac ctc ga
  cga gct agt ctt caa cgc caa
1 aga gga cgc tcg tgt ctt tcg gac



General PCR primer options

For PCR primers are usually 18-35 bases in length and should be designed such that they have complete sequence identity to the desired target fragment to be amplified. Parameters controllable by the user are primer length (12-500nt), melting temperature calculated by nearest neighbour thermodynamic parameters, theoretical primer PCR efficiency (quality at %) value, primer CG content, 3’end terminal enforcement, preferable 3’termini nucleotide sequence composition in degenerated formula and additional sequence at 5’ termini.

The other main parameters used for primer selection are: the general nucleotide structure of the primer such as linguistic complexity (nucleotide arrangement and composition); specificity; the melting temperature of the whole primer and the melting temperature at the 3’ and 5’ termini; a self-complementarity test; secondary (non-specific) binding search:

jPCR

PCR primers and probes design command lines

Any of these following commands must be written AFTER the sequence name or “>” (these commands are not case sensitive) and press Enter and the end of line. The commands can occupy any place in the command line.


PCR set-up examples




PCR Output Result

Application automatically generate results in "Results Tab" at tabulated format (ready for transferring to Excel sheet via copy and paste operations); the output results is easy to save as .XLS Text file, compatible for Excel or Open Office:

PrimerID Sequence(5'-3') Length
(bp)
Tm
(°C)
Tm
3'end(°C)
CG(%) Linguistic
complexity (%)
Quality
(%)
>1
1F1_1_13-34 aattgccccgcccaacacgggt 22 66,5 47,6 63,6 85 70
1F2_1_39-59 aggtgtgtgagcctcgactgt 21 60,1 44,5 57,1 81 94
1F3_1_52-72 tcgactgttcctcgccataag 21 56,6 40,6 52,4 96 93
1F4_1_64-86 cgccataagaaccctagtgcgga 23 60,8 40,6 56,5 97 97

Primers ID (Identifiers) designed format:




PCR product output, each line contains compatible primer pair (Forward and Reverse primers):

Forward
PrimerID
Sequence(5'-3') Tm(°C) Primer
Quality
(%)
Reverse
PrimerID
Sequence(5'-3') Tm(°C) Primer
Quality
(%)
PCR
Fragment
Size(bp)
Topt
(°C)
1F1_1_13-34 aattgccccgcccaacacgggt 66,2 93 1R3_1_529-552 gcatccggtttacaaggccgttg 61,1 97 540 60,2
1F1_1_13-34 aattgccccgcccaacacgggt 66,2 93 1R4_1_506-529 gttgaactgccgcgccgtcttac 62,8 95 517 60,7
1F1_1_13-34 aattgccccgcccaacacgggt 66,2 93 1R8_1_401-424 ggtcaggtgaagtggcatcctgc 62,3 97 412 60,3
1F2_1_39-59 aggtgtgtgagcctcgactgt 59,7 97 1R1_1_571-591 tatccgcagctcgttgcttc 57,3 92 553 59,1

Multiplex primer design

The user can also input options for the PCR product involving the minimum product size differences among the set of designed primer pairs. It also allows to set primer design conditions individually for each given sequences or using common options. The individual setting have highest priority to PCR primer or probe design than general settings. The result includes primer sequences for individual sequences, their compatible primer pairs with product size and annealing temperature and final result for compatible primer pairs for each sequence with all information includes primer pair sequences, product size and annealing temperature. It is ideally to design all primer pairs with near equal annealing temperature in single reaction. For most cases the multiplex PCR conditions are resisting to a small variation (up 7°C) of Ta between all primer pairs and PCR products. Synchronizing Tm for primer pair user can control from “Primer Design Options” or with command: -ptms5.

The annealing temperature must be optimal in order to guarantee effective amplification of the targets genomic sequence while minimizing the risk of unspecific amplification. To amplify the target genomic sequence effectively, the primers “quality” and properties should be highest. PCR primer design for multiplex PCR can be performed for standard or inverted PCR pairs or both of them. A minimum of two sequences must be implemented for this analysis. The program will find the compatible primer pairs for each sequence and will make a continuous numbering of pairs for all investigated sequences.
Another feature of the program, user can select not only compatible pairs of primers, as well as compatible single primers for different targets or sequences. That is, program can design both pairs of primers and single primers or only single primers for different targets:




Group-specific (family-specific primer set) and Unique PCR primers design

The group-specific amplification also call as family specific or universal amplification is most important tool for comparative studies of genes and genomes, including studies of evolution and cloning new sequences. The specific sequences that link to concrete organism can be discovered by DNA polymorphism in these conservative genome regions (genes, transposable or repeat elements). For detection DNA polymorphism in relative sequences will help with design PCR primers around this polymorphic region.

The overall strategy of designing group-specific PCR primers is standard PCR design of only to regions of sequence common to all sequences (hash-table base alignment).

The test primer complementarity performed with fast no gap local hash-table alignment includes parameters for amount of mismatches at the 3’-end of primers and primers similarity to target sequence.

Program automatically specify the alignment parameters (the same as for in silico PCR) for primers searching – “initial searching word size, >3 (default = 7), nt”, important length of 3'-end, 5...20, nt for testing mismatches, minimal complement primer length (>12, nt) and the local similarity (default = 80%)”.

An output PCR result contains the group-specific PCR primers from each sequence and compatible primers combination with product size and temperature annealing.

jPCR automatically designs larger sets of universal primer pairs for all given related sequences, identifies conservative regions without sequence alignment and generates suitable primers for all given sequences. All steps of algorithm are automatic and you can influence to the general options for primer design and alignment options. jPCR will work only with any source of related sequences as long as it is possible to found short consensus sequences. The quality of primer design is dependent on both on sequence relationship, phylogenetic similarity and suitability of the consensus sequence to the design of any good primers. Software is able to generate group-specific primers for each sequence independently, that suit for all sequences.


Unique PCR

The strategy for a unique PCR primer design is opposite to the group-specific PCR primers (probes) design. This case program search unique regions within a DNA sequence and automatically designing primers with minimal user intervention and maximum flexibility.


Calculation of optimal annealing temperature

The optimal annealing temperature (Ta) is the range of temperatures where efficiency of PCR amplification is maximal without non-specific products.
The most important values for estimating the Ta is the primer quality, the Tm of the primers and the length of PCR fragment.
Primers with high Tm´s (>60°C) can be used in PCRs with a wide Ta range compared to primers with low Tm´s (<50°C). The optimal annealing temperature for PCR is calculated directly as the value for the primer with the lowest Tm (Tmmin). However, PCR can work in temperatures up to 10 degrees higher than the Tm of the primer to favour primer target duplex formation, our empirical formulae:

Ta = Tmmin + ln(s),

where s is length of PCR fragment.

In our experience, almost all high-quality primers designed by jPCR in the default or «best» («Long distance» or «Quantitative» PCR) mode provide amplification at annealing temperatures from 68 to 72°C without loss of PCR efficiency, and show good amplification in varying PCR annealing temperatures and when using different DNA polymerases and buffers.



In silico (virtual) PCR or primers (probes) searching

This in silico tool is very attractive for quick analysing primer or probe through target sequences, for determination primer (probe) location, orientation, efficiency of binding, complementarity and Tm calculation.

The prediction appropriated short or long primer (probe) annealing site is only one way for PCR product prediction. Primer can bind many predicted sequences in template(s), but only sequences with few mismatches (1 or 2 depends from place and nucleotide) at 3’end of primer can be used for polymerase extension. The last 10-12 bases at 3’end of primer are sensitive to initiation of polymerase extension and general primer stability on binding template site. Single mismatch at these last 10 bases at 3’end of primer depends from the position and the structure can slightly reduced the primer binding and PCR efficiency. This software allows simultaneously testing single primer or list of the individual primer or probe with any length thorough multiplex target sequences. This test control by primer complementarity to target sequence performed with fast no gap alignment.




Oligonucleotides with degenerated sequence are fine for performing this test.
The probable PCR product can found for linear and cycle molecular, for standard, inverted PCR and for multiplex PCR.






In silico PCR against whole genome(s) or a list of chromosome

Open User must specify any file in a directory (click on any file) for each file in which to search for primer pair or a list of primers. The program will be consistent, a file-by-file, look at each file to the DNA sequence position of the primers. Optionally, files with the DNA sequence should be prepared in FASTA format (single or multiple independent sequences within the file), or only the DNA sequence. Program read only standard IUB/IUPAC nucleic acid codes characters and rejects anything else, low- and upper-case insensitive.





Oligo Test

Individual oligo are evaluated, it calculate primer Tm’s using default or other formulae for normal and degenerate nucleotide combinations, CG content, extinction coefficient, unit conversion (nmol per OD), mass (µg per OD), molecular weight, linguistic complexity, and primer PCR efficiency. Oligo is analysed for intra- and inter-molecular interactions to form dimers with for standard and degenerate oligonucleotides including LNA and other modifications (U=Uracil; I=Inosine; and LNA: dA=E, dC=F, dG=J, dT=L).

Users can select either DNA or RNA primers with normal or degenerate oligonucleotides or which can be modified with different labels (for example inosine, uridine or fluorescent dyes). Tools allow the choice of other nearest neighbour thermodynamic parameters or simple non thermodynamic Tm calculation formulae. For example, for non-thermodynamic Tm calculation of oligonucleotides, we suggest using the simple formulae:

Tm = 2(A + T + U) + 4(G + C) (for short < 7 bases)

or

Tm = 77.1 + 11.7lg [K+] + 0.41(GC %) - 528/L


Program perform analyses on-type, which allow users to see the results immediately on screen. They can also calculate the volume of solvent require to attain a specific concentration from the known mass (mg), OD or moles of dry oligonucleotide.










Random DNA Generation

Using TAB editor, you can select the length (1,000-10,000 nt) for generation random DNA sequence with “Generate Random DNA”.



Searching for Similar Sequences (or Primers)

jPCR (and FastPCR software) allows instant searches for similarities between short or long DNA sequences by simultaneous matching of multiple motifs and can be a useful tool for the identification of distant relationships among DNA sequences and primers.







The tools are written in Java with NetBeans IDE (Oracle) and require the Java Runtime Environment (JRE) on a computer.

Note: If you don't see the Java Web Start application's Java Web Start button, Java application needs the Java Runtime Environment (JRE) or complete Java Development Kit (JDK) (Sun), can be downloaded from java.com), and you might need to enable the JavaScript interpreter in your browser so that the Deployment Toolkit script can function properly.

To determine which version of Java your web browser is using, please visit javatester or java.com.

Contact
Dr. Ruslan Kalendar


Reference apply to all Web Tools update, if you use it in your work please cite:
Kalendar R, Lee D, Schulman AH 2011. Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis. Genomics, 98(2): 137-144.
[http://primerdigital.com/tools/]



Copyright

The copyrights and other rights to the materials on the PrimerDigital website are owned by PrimerDigital.
You are authorized to view the materials at this website only for your internal information purposes provided that you:
(i) retain all notices contained in the original materials;
(ii) only use images with surrounding text relating to the images; and
(iii) include the following copyright notice.
These computer programs are protected by copyright law and international treaties.
Unauthorized reproduction or distribution of this program, or any portion of it, may be result in severe civil and criminal penalties, and will be prosecuted to the maximum extent possible under law.
You are also expressly prohibited from reverse engineering, decompiling, translating, disassembling, deciphering, decrypting, or otherwise attempting to discover the source code of the licensed works as the licensed works contain proprietary material of licensor.
You are prohibited from using these softwares with a commercial software or hardware product ("commercial product") whose purpose is to "transcode" or convert application content into an alternate programs.