PrimerDigital

The prediction appropriated short or long primer (probe) annealing site is only one way for PCR product prediction. Primer can bind many predicted sequences in template, but only sequences with few mismatches (1 or 2 depends from place and nucleotide) at 3’end of primer can be used for polymerase extension. The last 10-12 bases at 3’end of primer are sensitive to initiation of polymerase extension and general primer stability on binding template site. Single mismatch at these last 10 bases at 3’end of primer depends from the position and the structure can slightly reduced the primer binding and PCR efficiency. This software allows simultaneously testing single primer or list of the individual primer or probe with any length thorough multiplex target sequences. This test control by primer complementarity to target sequence performed with fast no gap alignment.

Probe with not complemental tail on 5’end and on 3’end to target is not problem for performing this test.

Oligonucleotides with degenerated sequence are fine for performing this test.
The probable PCR product can fond for linear and cycle molecular, for standard, inverted PCR and for multiplex PCR.

This in silico tool is very attractive for quick analysing primer or probe through target sequences, for determination primer (probe) location, orientation, efficiency of binding, complementarity and Tm calculation.

• Enter primer sequences: Paste the primer sequence(s) in the additional editor in any format acceptable for FastPCR
• C >> T bisulphite conversion: bisulphite modified genome sequence, design of specific PCR primers for in silico bisulphite conversion for both strands - only cytosines not followed by guanidine (CpG methylation) will be replaced by thymines; 
• Restrict analysis to F/R primer pairs: the program will recognise paired primers (Forward F Reverse R) (see below).
  For this type of analysis, primers from the same pair(s) must have identical names but finishing using “R or F” (e.g. >seq1R and >seq1F form a pair; or EVEN: >F and >R). The name length and structure (including "F" and "R" inside names) are not important. Moreover, the program is not limited in one unique pair per primers: for one "Forward" primer, it can be several "reverse", the same for “reverse” primer:
  

1aF agggagtagcttacctcgct 20 56.6 31.6 55.0 95.0 87
2bF gcgaaaaccaagtgcttacct 21 55.9 29.4 47.6 95.2 101
3cF tcctcaagcgaaaaccaatccaca 24 58.8 29.9 45.8 92.5 101
1aR ggtttcgtcggtcgctgctt 20 60.1 36.6 60.0 85.0 75
2bR agtcaacggcgtcgcagcgttct 23 64.7 36.6 60.9 92.2 99
3cR ggtcgcgacatccgttccaa 20 59.7 32.6 60.0 95.0 82

The Output file will be presented as follows:

In silico Primer(s) search for: >1

>1af
5'-agggagtagcttacctcgct

Position:  234 -> 253 20bp 100 %   Tm = 56.6°C

5-agggagtagcttacctcgct->
  ||||||||||||||||||||
cctccctcatcgaatggagcgaacag

>2bf
5'-gcgaaaaccaagtgcttacct

Position:  263 -> 283 21bp 100 %   Tm = 55.9°C

5-gcgaaaaccaagtgcttacct->
  |||||||||||||||||||||
ttcgcttttggttcacgaatggagcga

>1af
5'-agggagtagcttacctcgct
>1ar
5'-ggtttcgtcggtcgctgctt
 PCR product size: 898bp

>2bf
5'-gcgaaaaccaagtgcttacct
>2br
5'-agtcaacggcgtcgcagcgttct
 PCR product size: 844bp

>3cf
5'-tcctcaagcgaaaaccaatccaca
>3cr
5'-ggtcgcgacatccgttccaa
 PCR product size: 526bp


Web tool for in silico PCR.