PrimerDigital


Output Result


FastPCR automatically generate results in Results Tab at tabulated format (ready for transferring to Excel sheet, press), output results is easy to save as .XLS or .RTF Text file, compatible for Excel or Open Office or copy-paste to clipboard:


Primers shown at tabulated format (ready for transferring to Excel sheet):

PrimerID Sequence(5'-3') Length
(bp) 		Tm
(°C) 		Tm
3'end(°C) 		CG(%) Linguistic
complexity
(%) 		Quality
(%)
>1 
1F1_1_13-34 aattgccccgcccaacacgggt 22 66,2 35,6 63,6 92 93
1F2_1_39-59 aggtgtgtgagcctcgactgt 21 59,7 33,3 57,1 89 97
1F3_1_52-72 tcgactgttcctcgccataag 21 56,3 29,9 52,4 98 91
1F4_1_64-86 cgccataagaaccctagtgcgga 23 60,6 33,5 56,5 98 97

Primers ID (Identifiers) designed format:




PCR product output, each line contains compatible primer pair (Forward and Reverse primers):
Forward
PrimerID		 Sequence(5'-3') Tm(°C) Primer
Quality
(%) 		Reverse
PrimerID 		Sequence(5'-3') Tm(°C) Primer
Quality
(%) 		PCR
Fragment
Size(bp) 		Topt
(°C) 
1F1_1_13-34 aattgccccgcccaacacgggt 66,2 93 1R3_1_529-552 gcatccggtttacaaggccgttg 61,1 97 540 60,2
1F1_1_13-34 aattgccccgcccaacacgggt 66,2 93 1R4_1_506-529 gttgaactgccgcgccgtcttac 62,8 95 517 60,7
1F1_1_13-34 aattgccccgcccaacacgggt 66,2 93 1R8_1_401-424 ggtcaggtgaagtggcatcctgc 62,3 97 412 60,3
1F2_1_39-59 aggtgtgtgagcctcgactgt 59,7 97 1R1_1_571-591 tatccgcagctcgttgcttc 57,3 92 553 59,1



Manual